Glossary

The 3D structure of a protein depends on its amino acid sequence.

Energy-storing molecule of cells. In eukaryotes ATP is generally produced in the mitochondria.

Basic unit of a protein. Every protein is a succession of amino acids linked to one another. There are 20 different amino acids, each of which is symbolised by a letter: A (alanine), C (cysteine), D (asparagine), E (glutamine), F, G, H, I, K, L, M, N, P, Q, R, S, T, V, W, and Y.

An antibiotic is a natural substance produced by bacteria or fungi for instance. Much like a chemical weapon, an antibiotic will act upon other species of bacteria or fungi by either killing them or slowing down their proliferation. Currently, many antibiotics are made in the laboratory and are therefore artificial.

An antibody is a protein that is produced by cells known as B lymphocytes, which are part of the immune system. Antibodies are found in different fluids (blood, saliva...). Their role is to detect the presence of foreign bodies, i.e. other proteins or bits of protein which belong to a virus for example. When this happens, a defence response, known as the immune reaction, is triggered off and the intruder is eliminated. Antibodies can also recognise cancer cells.

An antigen is generally a sugar, a protein, or bit of protein, which belongs to something foreign which has entered our body (pollen, virus, bacteria...). Antigens are like flags which warn our body that there is an intruder. They are recognised by antibodies, and are at the heart of the immune reaction.

Basic unit of matter (inert and living), consisting of a nucleus around which electrons rotate.

Bacteria are unicellular micro-organisms that have no nucleus and can live in a variety of environments (air, soil, water, other organisms...). In common usage, 'bacteria' includes bacteria and archaea (formerly known as archaebacteria) that generally live in extreme conditions (high acidity and elevated temperatures for instance).

Branch of biology that studies chemical reactions in living organisms, such as the production of energy in cells, or the synthesis and degradation of lipids.

Bioinformatics is a field in the life sciences which uses computer programs, mathematics and statistics to store, analyse and visualise biological data such as DNA sequences (genomes), protein sequences or experimental results.

Field of science where techniques, which make use of living organisms (bacteria, yeast...) or some of their genes or proteins, are applied to the food industry, agriculture, pharmaceuticals and medicine.

Abnormal proliferation of cells (tumour), caused by uncontrolled cell division.

The cell is the smallest unit necessary for the constitution of a living being. The number of cells in a given species varies: bacteria are made up of only one cell, the common earthworm, C.elegans, is made up of about 1’000 cells, while you need 100’000 billion cells to make a human being.

Protein lodged in a cell's membrane that acts like a pore through which only certain small molecules are permitted to pass.

A chromosome is a more or less compactly wound thread of DNA, a little like a ball of wool. In some organisms, including humans, chromosomes appear in their popular 'X' form at the time of cell division, and dark and light horizontal bands alternate along their length when specific colourings are used. The topography of these bands is characteristic of a chromosome and used to identify it.

DNA is a chain of nucleotides that are linked to one another via chemical bonds. There are four different nucleotides: adenine, cytosine, guanine and thymine symbolised by A, C, G and T respectively. The order of nucleotides is very precise in DNA, and is the basis of genetic information. More often than not, DNA has a 'double helix' structure made up of two long strands. The strands are linked to each other via the nucleotides, where adenine (A) always binds to thymine (T), and guanine (G) to cytosine (C), rather like a twisted ladder.

Computerised encyclopedia that organises data in a very structured way in order to store huge quantities of information as efficiently as possible (synonym: database).

Computerised encyclopedia that organises data in a very structured way in order to store huge quantities of information as efficiently as possible (synonym: databank).

Region of about 200 amino acids within a protein, which has a defined structure and a particular role. On average, one protein is made up of 2 to 3 different domains.

An enzyme is a protein which accelerates chemical reactions in an organism. As an example, proteases are enzymes that are able to sever other proteins, just like a pair of scissors.

Eukaryotes are organisms whose cells have a nucleus in which the chromosomes are confined. Animals (humans included), plants and fungi are eukaryotes. Prokaryotes, on the other hand, do not have a nucleus and their chromosomes are ‘free’.

Describes the transformations undergone by living organisms (animals, plants and bacteria) as time goes by. Evolution is the consequence of gradual genetic changes. It drives the creation of new species from a common ancestor. The evolution of species can be represented by a phylogenetic tree.

The role of a protein (or any other molecule) in a cell or an organism. As an example, amongst many other functions, proteins can be hormones, antibodies, enzymes or receptors.

A gene is a piece of DNA. One gene can carry the recipe to make a protein, for example.

The genetic code is almost universal. It is used by Nature to convert (translate) a gene (sequence of nucleotides) into a protein (sequence of amino acids). One amino acid is encoded by 3 nucleotides (or 'codon').

Illness of genetic origin (for example due to a defective gene), which can reappear in a family in successive generations.

A genetically modified organism is an organism (bacteria, animals, plants) whose genome has been altered. This usually involves adding one or more genes from an organism’s genome into another. Genetically modified organisms are used to study diseases, in drug design or for agricultural purposes for example.

Derived from 'genome', the field of genomics includes all the techniques used to study genomes.

Molecule produced by a gland and generally secreted into the blood so that it can reach the organ(s) it needs to act upon. As an example, insulin is a hormone produced by the pancreas, which regulates the level of sugar in blood. Certain hormones are proteins (insulin, EPO).

An organism’s defense system against infectious agents (fungi, bacteria, viruses) and defective cells (cancer).

Damaged part of tissue caused by an illness, an infection or an accident.

Lipids are molecules that are also known as fatty acids or, more colloquially, fats.

The lymph is a fluid which is rich in proteins and immune cells. It circulates throughout our body, and soaks all our organs. The lymph plays an important role in the immune system's response.

Envelope which defines a cell and its compartments (the nucleus and mitochondria for example). A membrane is mainly made out of lipids and proteins.

The sum of synthesis and degradation reactions that take place in a cell or an organism.

Organism which is generally microscopic and has its own genetic information. For example: viruses, bacteria and unicellular fungi and algae.

Cellular compartment or 'organelle'. Mitochondria are like tiny power plants that produce the energy an organism needs. The energy produced is called ATP.

A branch of biology which studies the molecules of living matter (DNA, proteins...).

A molecule is an assembly of atoms.

A mutation occurs when one or more nucleotides are modified in a DNA sequence. Such a mutation can involve changing the nucleotides identity, or the suppression or the addition of one or more nucleotides. When a mutation affects a gene, it can alter the corresponding protein's function and thus cause a disease. Mutations can happen spontaneously or be the result of chemical agents, such as UV radiation or a virus. It is estimated that about 10 mutations occur every time a cell divides. Mutations are the source of evolution.

The nervous system is composed of billions of neurons that form a communication network between the different parts of an organism.

Neurons are cells which make up the greater part of the nervous system. Neurons transport and transmit nerve signals to other neurons.

Neurotransmitters are small molecules that transmit information from one neuron to another. These small chemical messengers are freed at the very tip of a neuron and cross a space – known as the synaptic cleft – to bind to receptors on a neighbouring neuron.

Basic unit of DNA and RNA. Nucleotides are molecules symbolised by letters. In DNA, A is for adenine, T for thymine, G for guanine and C for cytosine. In RNA, T is replaced by U for uracile.

An organism that is dependent on another organism, or host. Without a host, a parasite cannot survive or reproduce. A few examples: tapeworms, Plasmodium falciparum which causes malaria, and viruses.

Term used to designate either a protein composed of a small number of amino acids (about 50), or a protein fragment.

Chemical substance that acts as a messenger between individuals of the same species. In particular, certain pheromones play a role in sexual attraction.

The sequence of a given gene can vary from one individual to another. These variations are called ‘polymorphisms’. Polymorphisms can sometimes give rise to a difference in the gene’s corresponding protein sequence. Depending on the environment, a polymorphism can be ‘neutral’ (i.e. involve no change in an individual), can predispose an individual to an illness or, on the contrary, it can become an advantage for those who carry it (resistance to a disease for example). In humans, it has been estimated that there is about 1 polymorphism every 1000 nucleotides.

A prokaryote is an organism composed of only one cell, whose DNA is not confined to a nucleus – as opposed to eukaryotes. Bacteria and archaea are prokaryotes.

Like pearls in a necklace, a protein is a succession of amino acids that are linked to one another via chemical bonds. There are 20 different amino acids. Proteins are of variable length and fold into specific shapes – their 3D structure – which determine their function. Proteins are essential for a living being’s construction and activity.

Process which manufactures proteins in cells. Protein recipes are found in genes, which are photocopied to produce what is known as a messenger RNA (mRNA). Proteins are made by ribosomes. Ribosomes read the mRNA and then assemble the amino acids using the genetic code, thus synthesising a protein.

A proteome designates the sum of proteins that are found in an organism, at a given time. Butterflies and caterpillars have exactly the same genomes, yet their proteomes are very different.

Term which encompasses all the techniques used to study proteomes.

RNA can be described as a photocopy of a piece of DNA. Its chemical composition is very close to that of DNA but is only made up of one strand. RNA acts as a 'messenger', and is essential in the synthesis of proteins. There are also other types of RNA which are not directly involved in protein synthesis.

A receptor interacts with other molecules or proteins. Besides other activities, receptors help messages enter a cell.

A ribosome is a protein factory. It reads the information held in the messenger RNA and translates it into a protein, using the genetic code. Every cell has thousands of ribosomes.

Order in which are linked the basic components of a macromolecule. A DNA sequence is a succession of nucleotides symbolized by letters: A, T, G and C (for example: CAAGGAAGTTTGGCAGAGGA). A protein sequence is a succession of amino acids symbolized by the following letters (20 different ones): A, C , D, E, F, G, H, I, K, L, M, N, P, Q, R, S, T, V, W, and Y (for example: MALWMRLLPLLALLALW).

Techniques used to determine the order of nucleotides in DNA or amino acids in a protein.

Every cell in the human body has two copies of each chromosome, i.e. 23 pairs of chromosomes. There is only one pair of chromosomes that determines an individual's gender. In girls, it is the XX pair of chromosomes while, in boys, it is the XY pair.

Sugars are also known under the name of carbohydrates or, more rarely, glucids.

Sum of cells that contribute to a common function such as heart cells, liver cells and kidney cells. An organ is composed of different tissues. For example, skin is made up of three tissues: epidermis, dermis and hypodermis.

Toxic substance produced by certain living organisms, in particular bacteria, snakes and insects.

A vaccine stimulates the immune system without provoking an actual infection. It leaves behind a ‘memory’ of itself, which allows a fast and effective restart of the immune system if the infectious agent is re-encountered. A vaccine either contains a micro-organism (virus or bacteria) that has been inactivated, or a protein or protein fragment which belongs to the infectious agent.

Parasitic micro-organism. A virus is composed of a protein shell which protects its genetic information (DNA or RNA).

Abbreviation of 'base pair', used to indicate the number of nucleotides that are found in a sequence of DNA or RNA.