• 3-D-Struktur

    3-D-Struktur

    Die dreidimensionale Struktur eines Proteins ist von seiner Aminosäuresequenz abhängig.
  • Aminosäure

    Aminosäure

    Aminosäuren sind die Bausteine der Proteine. Jedes Protein ist eine Kette aus Aminosäuren. Es gibt 20 verschiedene Aminosäuren, und jede wird durch einen Buchstaben symbolisiert: A (Alanin), C (Cystein), D (Asparagin), E (Glutamin), F, G, H, I, K, L, M, N, P, Q, R, S, T, V, W und Y.
  • Antibiotikum

    Antibiotikum

    Ein Antibiotikum ist eine natürliche Substanz, die beispielsweise von Bakterien oder Pilzen produziert wird. Ähnlich wie eine chemische Waffe wirkt das Antibiotikum auf andere Bakterien oder Pilze tödlich oder verlangsamt ihr Wachstum. Heute werden viele Antibiotika künstlich im Labor hergestellt.
  • Antigen

    Antigen

    Ein Antigen funktioniert wie ein Fähnchen, das unserem Körper die Anwesenheit eines fremden Eindringlings anzeigt. Im Allgemeinen ist ein Antigen ein Zucker, ein Protein oder ein Proteinfragment, das von dem Fremdkörper (Pollen, Virus, Bakterium, ...) stammt. Antigene werden durch Antikörper erkannt und stehen somit am Anfang der Immunreaktion.
  • Antikörper

    Antikörper

    Antikörper sind Proteine, die von bestimmten Zellen des Immunsystems eines Organismus, den sogenannten B-Lymphozyten, produziert werden und in verschiedenen Flüssigkeiten (Blut, Speichel ...) zirkulieren. Antikörper erkennen Fremdkörper, wie beispielsweise virale Proteine oder Proteinfragmente. Dieses Erkennen löst eine Abwehrreaktion aus, die sogenannte Immunantwort, wodurch der Eindringling eliminiert wird. Antikörper können auch Krebszellen erkennen.
  • Atom

    Atom

    Ein Atom ist die Grundeinheit aller Materie (inert oder lebend). Es besteht aus einem Atomkern und den ihn umgebenden Elektronen.
  • ATP

    ATP

    Ein Energie speicherndes Molekül der Zelle. In Eukaryoten wird ATP im Allgemeinen in den Mitochondrien produziert.
  • Bakterium

    Bakterium

    Ein Bakterium ist ein einzelliger Mikroorganismus ohne Zellkern, der in einer Vielzahl von Umgebungen leben kann (Luft, Erde, Wasser, andere Organismen, ...). Im allgemeinen Sprachgebrauch beinhaltet der Begriff „Bakterien“ sowohl Bakterien als auch Archaeen (vormals: Archaebakterien). Letztere können unter extremen (z. B. sauren oder heißen) Bedingungen leben.
  • Biochemie

    Biochemie

    Die Biochemie ist ein Teilbereich der Biologie, der chemische Reaktionen in lebenden Organismen untersucht, wie beispielsweise die Energiegewinnung in Zellen oder die Synthese und den Abbau von Fetten (Lipiden).
  • Bioinformatik

    Bioinformatik

    Die Bioinformatik ist ein Fach der Biowissenschaften, das Computerprogramme, Mathematik und Statistik nutzt, um biologische Daten (DNA Sequenzen / Genome, Proteinsequenzen oder experimentelle Daten) zu speichern, zu analysieren und zu visualisieren.
  • Biotechnologie

    Biotechnologie

    Die Biotechnologie ist eine Wissenschaft, in der Techniken entwickelt werden, die lebende Organismen (Bakterien, Hefen, ...) oder einige ihrer Gene oder Proteine nutzen. Diese Techniken werden in der Landwirtschaft, in der Lebensmittel- und pharmazeutischen Industrie und in der Medizin angewandt.
  • bp

    bp

    Abkürzung für „Basenpaare“; diese bezeichnet die Anzahl von Nukleotiden in einer DNA- oder RNA-Sequenz.
  • Chromosom

    Chromosom

    Ein Chromosom ist wie ein mehr oder weniger dicht aufgewickeltes Wollknäuel mit DNA als Faden. Bei manchen Organismen, inklusive dem Menschen, erscheinen die Chromosomen zum Zeitpunkt der Zellteilung in ihrer bekannten „X“-Form. Durch bestimmte Färbetechniken lassen sich zudem helle und dunkle Horizontalstreifen (Banden) im Chromosom sichtbar machen. Die Topografie dieser Banden ist charakteristisch für jedes Chromosom und hilft bei ihrer Identifizierung.
  • Chromosomenpaare

    Chromosomenpaare

    Ein Chromosom ist wie ein mehr oder weniger dicht aufgewickeltes Wollknäuel mit DNA als Faden. Bei manchen Organismen, inklusive dem Menschen, erscheinen die Chromosomen zum Zeitpunkt der Zellteilung in ihrer bekannten „X“-Form. Durch bestimmte Färbetechniken lassen sich zudem helle und dunkle Horizontalstreifen (Banden) im Chromosom sichtbar machen. Die Topografie dieser Banden ist charakteristisch für jedes Chromosom und hilft bei ihrer Identifizierung.
  • Datenbank

    Datenbank

    Eine elektronische Enzyklopädie, die Daten in einer sehr strukturierten Weise ordnet, um riesige Informationsmengen so effizient wie möglich zu speichern.
  • DNA

    DNA

    DNA ist eine Kette aus Nukleotiden, die durch chemische Bindungen verknüpft sind. Es gibt vier verschiedene Nukleotide: Adenosin, Cytosin, Guanin und Thymin, symbolisiert durch die Buchstaben A, C, G und T. Die Anordnung der Nukleotide in einer DNA ist strikt festgelegt und damit die Grundlage der genetischen Information. Meistens liegt DNA als sogenannte Doppelhelix vor: zwei DNA-Stränge, die umeinander verdreht sind. Diese Stränge sind über die Nukleotide miteinander verknüpft, wobei Adenosin (A) immer an Thymin (T) bindet und Cystein (C) an Guanin (G).
  • Domäne

    Domäne

    Eine Domäne ist eine - etwa 200 Aminosäuren lange - Region innerhalb eines Proteins, die eine definierte Struktur sowie eine spezielle Funktion besitzt. Ein Protein besitzt durchschnittlich zwei bis drei Domänen.
  • Enzym

    Enzym

    Ein Enzym ist ein Protein, das die chemischen Reaktionen in einem Organismus beschleunigt. Ein Beispiel sind Proteasen, die, wie Scheren, andere Proteine zerschneiden.
  • Enzyme

    Enzyme

  • Erbkrankheit

    Erbkrankheit

    Eine genetisch bedingte Krankheit (verursacht beispielsweise durch ein defektes Gen), die innerhalb einer Familie von Generation zu Generation weitergegeben wird.
  • Eukaryoten

    Eukaryoten

    Zu den eukaryoten Organismen zählen alle diejenigen, die einen Zellkern besitzen, in dem die Chromosomen enthalten sind. Tiere (auch der Mensch), Pflanzen und Pilze sind Eukaryoten. Im Gegensatz dazu besitzen Prokaryoten keinen Zellkern und ihre Chromosomen sind „frei“.
  • Evolution

    Evolution

    Die Evolution beschreibt die Umwandlung, die sich an lebenden Organismen (Tiere, Pflanzen und Bakterien) über Generationen hinweg vollzieht. Die Evolution ist das Ergebnis gradueller genetischer Veränderungen. Sie ist verantwortlich für die Entstehung neuer Arten, ausgehend von gemeinsamen Vorfahren. Die Entstehungsgeschichte verwandter Arten kann durch einen phylogenetischen Baum dargestellt werden.
  • Funktion

    Funktion

    Die Rolle eines Proteins (oder eines Moleküls) in einer Zelle oder in einem Organismus. Einige Beispiele der vielfältigen Funktionen: Proteine können Hormone, Antikörper, Enzyme oder Rezeptoren sein.
  • Gen

    Gen

    Ein Gen ist ein DNA-Stück. Ein Gen enthält, wie ein Kochrezept, die Information für den Bau eines Proteins.
  • Gene

    Gene

    Ein Gen ist ein DNA-Stück. Ein Gen enthält, wie ein Kochrezept, die Information für den Bau eines Proteins.
  • Genetisch verändert

    Genetisch verändert

    Ein genetisch veränderter Organismus (Abk.: GVO) ist ein Organismus (Bakterium, Tier, Pflanze), dessen Genom modifiziert wurde. Typischerweise bedeutet dies das gezielte Einbringen eines oder mehrerer Gene aus einem anderen Organismus in das Genom. Genetisch veränderte Organismen werden beispielsweise bei der Erforschung von Krankheiten, für das Design neuer Medikamente und in der Landwirtschaft genutzt.
  • Genetischer Code

    Genetischer Code

    Der genetische Code ist eine Regel, nach der ein Gen (= Nukleotidsequenz) in ein Protein (= Aminosäuresequenz) übersetzt wird. Eine Aminosäure ist durch drei Nukleotide (= ein Codon) definiert. Der genetische Code ist im Prinzip bis auf wenige Ausnahmen für alle Lebewesen gleich.
  • Genom

    Genom

    = Erbgut. Die Gesamtheit der DNA in einer Zelle. Im Allgemeinen besitzt jede Zelle eines Organismus das gleiche Genom.
  • Genomik

    Genomik

    Genomik leitet sich von „Genom“ ab. Genomik bezeichnet alle Techniken, die zum Studium von Genomen genutzt werden.
  • Geschlechtschromosom

    Geschlechtschromosom

    = Gonosom. Jede Körperzelle im Menschen besitzt zwei Kopien von jedem Chromosom, also 23 Chromosomenpaare. Doch nur ein Chromosomenpaar bestimmt das Geschlecht eines Individuums. Bei Mädchen besteht dieses Paar aus zwei X-Chromosomen, während Jungen ein X- und ein Y-Chromosom besitzen.
  • Gewebe

    Gewebe

    Eine Ansammlung von Zellen, die ähnliche oder gleiche Funktionen besitzen, wie beispielsweise Herz-, Leber- oder Nierenzellen. Ein Organ besteht aus verschiedenen Geweben. So ist die Haut ein Organ aus drei Geweben: Epidermis (Oberhaut), Dermis (Lederhaut) und Subcutis (Unterhaut).
  • Hormon

    Hormon

    Hormone sind Moleküle, die von Drüsen gebildet werden und meist ins Blut abgegeben werden, um ihre Zielorgane zu erreichen. So ist beispielsweise Insulin ein Hormon, das von der Bauchspeicheldrüse gebildet wird und den Zuckerspiegel im Blut reguliert. Manche Hormone sind Proteine (Insulin, EPO).
  • Immunsystem

    Immunsystem

    Das Abwehrsystem eines Organismus gegen infektiöse Erreger (Pilze, Bakterien, Viren) und geschädigte Zellen (Krebszellen).
  • Impfstoff

    Impfstoff

    = Vakzine. Ein Impfstoff soll das Immunsystem stimulieren, ohne eine wirkliche Infektion auszulösen. Er hinterlässt dabei eine ‚Erinnerung‘ an sich selbst, die es dem Immunsystem ermöglicht, schneller und gezielter auf eine echte Infektion zu reagieren. Ein Impfstoff besteht entweder aus einem unschädlich gemachten (= inaktivierten) Virus bzw. Bakterium, oder er ist ein Protein oder Proteinfragment des infektiösen Erregers.
  • Kanalproteine

    Kanalproteine

    Proteine in der Zellmembran, die wie eine Pore kleine Moleküle selektiv passieren lassen.
  • Krebs

    Krebs

    Abnorme Wucherung von Zellen (Tumor) aufgrund unkontrollierter Zellteilung.
  • Lipid

    Lipid

    Lipide sind Moleküle, besser bekannt als Fettsäuren oder, umgangssprachlich, Fette.
  • Lymphe

    Lymphe

    Die Lymphe ist eine Körperflüssigkeit reich an Proteinen und Immunzellen, die das Bindeglied zwischen der Gewebsflüssigkeit (Interzellularflüssigkeit) und dem Blutplasma bildet. Das Lymphsystem mit den Lymphgefäßen als Leitungsbahnen ist auf den Transport von Nähr- und Abfallstoffen spezialisiert und entsorgt in den Lymphknoten auch Krankheitserreger wie Bakterien und Fremdkörper.
  • Läsion

    Läsion

    Eine Läsion ist eine geschädigte Gewebepartie aufgrund einer Erkrankung, einer Infektion oder eines Unfalls.
  • Membran

    Membran

    Eine Membran ist eine Hülle, die eine Zelle und ihre Kompartimente (z. B.: Kern, Mitochondrien) umgibt. Eine Membran besteht hauptsächlich aus Lipiden und Proteinen.
  • Mikroorganismus

    Mikroorganismus

    Mikroskopisch kleine Organismen mit eigenem Erbgut, wie beispielsweise Viren, Bakterien und einzellige Algen oder Pilze.
  • Mitochondrium

    Mitochondrium

    Ein Kompartiment der Zelle oder auch „ein Organell“. Mitochondrien sind wie kleine Kraftwerke, die für einen Organismus die benötigte Energie produzieren. Diese Energie wird ATP genannt.
  • Molekularbiologie

    Molekularbiologie

    Die Molekularbiologie ist ein Teilbereich der Biologie, in dem die Moleküle des Lebens (DNA, Proteine, ...) untersucht werden.
  • Molekül

    Molekül

    Ein Molekül ist ein Konstrukt aus Atomen.
  • Mutation

    Mutation

    Eine Mutation ist ein Ereignis, bei dem ein oder mehrere Nukleotide in der DNA-Sequenz verändert werden. Dabei kann es zu einem Austausch, einem Verlust oder einer Zunahme von Nukleotiden kommen. Betrifft eine Mutation ein Gen, dann kann es zu einer Veränderung der Funktion des entsprechenden Proteins kommen und infolgedessen zu einer Erkrankung. Mutationen können spontan entstehen oder durch Chemikalien, UV-Strahlen oder Viren induziert werden. Schätzungsweise entstehen während jeder Zellteilung etwa 10 Mutationen. Mutationen sind die Ursache der Evolution.
  • Nervensystem

    Nervensystem

    Das Nervensystem besteht aus Milliarden von Neuronen (= Nervenzellen), die ein Kommunikationsnetzwerk zwischen den verschiedenen Teilen eines Organismus bilden.
  • Neuron

    Neuron

    = Nervenzelle. Neuronen sind diejenigen Zellen, die den Hauptbestandteil des Nervensystems bilden. Sie leiten Signale zu anderen Neuronen weiter.
  • Neurotransmitter

    Neurotransmitter

    Neurotransmitter sind kleine Moleküle, die Informationen von einer Nervenzelle zur nächsten übertragen. Diese chemischen Botenstoffe werden an der Spitze einer Nervenzelle freigesetzt und überqueren einen Zwischenraum - den synaptischen Spalt - um an die Rezeptoren der benachbarten Nervenzelle zu binden.
  • Nukleotid

    Nukleotid

    Ein Nukleotid ist der Grundbaustein der DNA und RNA. Nukleotide sind kleine Moleküle, die durch Buchstaben symbolisiert werden. In DNA steht A für Adenosin, T für Thymin, G für Guanin und C für Cytosin. Bei RNA ist Thymin (=T) durch das Nukleotid Uracil (=U) ersetzt.
  • Parasit

    Parasit

    Ein Parasit ist ein Lebewesen, das von einem anderen Organismus, seinem Wirt, abhängig ist. Ohne den Wirt kann ein Parasit weder überleben noch sich vermehren. Beispiele für Parasiten sind: Bandwürmer, der Malariaerreger Plasmodium falciparum, sowie Viren.
  • pb

    pb

    Abkürzung für „Basenpaare“; diese bezeichnet die Anzahl von Nukleotiden in einer DNA- oder RNA-Sequenz.
  • Peptid

    Peptid

    Ein Peptid ist die Bezeichnung für ein kleines Protein (mit etwa 50 Aminosäuren), aber auch für ein Proteinfragment.
  • Pheromon

    Pheromon

    Ein Pheromon ist eine chemische Substanz, die als Botenstoff zwischen Individuen der gleichen Art fungiert. Bei manchen Organismen spielen Pheromone eine wichtige Rolle bei der sexuellen Anziehung.
  • Phylogenetischen Bäumen

    Phylogenetischen Bäumen

    Ein phylogenetischer Baum ist ein Stammbaum, der die evolutionären Beziehungen zwischen verschiedenen Arten darstellt, von denen man vermutet, dass sie einen gemeinsamen Vorfahren besitzen. Der phylogenetische Baum gleicht somit einem Familienstammbaum, der die verwandtschaftlichen Beziehungen zwischen den einzelnen Familienmitgliedern darstellt.
  • Polymorphismus

    Polymorphismus

    Die Sequenz eines Gens kann sich von Individuum zu Individuum leicht unterscheiden. Diese Variationen nennt man „Polymorphismen“. Ein Polymorphismus eines Gens kann auch zu einem Unterschied im zugehörigen Protein führen. Abhängig von Umwelteinflüssen kann ein Polymorphismus „neutral“ sein und zu keiner Änderung des Individuums führen. Er kann aber auch zu einer Prädisposition für eine Krankheit führen, oder, im Gegenteil, einen Vorteil für seinen Träger haben (z. B.: eine Resistenz für eine Krankheit). Beim Menschen geht man von etwa 1 Polymorphismus alle 1000 Nukleotide aus.
  • Prokaryoten

    Prokaryoten

    Ein Prokaryot ist ein einzelliger Organismus, dessen DNA, im Gegensatz zu Eukaryoten, nicht in einem Kern eingeschlossen ist.
  • Proteinbiosynthese

    Proteinbiosynthese

    Der Prozess, der Proteine in der Zelle herstellt. Die Proteinrezepte sind in den Genen enthalten, und werden als Kopie in Form der Boten-RNA an die Ribosomen gesandt. Die Ribosomen sind die eigentlichen Proteinfabriken, welche die Informationen der RNA mithilfe des genetischen Codes in Proteine umschreiben, und somit die Proteine „synthetisieren“.
  • Proteine

    Proteine

    Wie Perlen in einer Kette, so besteht ein Protein aus einer Aneinanderreihung von Aminosäuren, die über chemische Brücken verbunden sind. Es gibt 20 verschiedene Aminosäuren. Proteine besitzen unterschiedliche Länge und falten sich zu einer bestimmten, dreidimensionalen Form, die ihre Funktion bestimmt. Proteine sind für den Bau und die Funktionsfähigkeit eines Lebewesens unabkömmlich.
  • Proteome

    Proteome

    Ein Proteom beschreibt die Gesamtheit aller Proteine eines Organismus zu einem bestimmten Zeitpunkt. Schmetterlinge und Raupen besitzen genau das gleiche Genom, aber ihre Proteome sind sehr unterschiedlich.
  • Proteomik

    Proteomik

    Ein Begriff, der alle Techniken zum Studium von Proteomen umfasst.
  • Pylogenetischer Baum

    Pylogenetischer Baum

    Ein phylogenetischer Baum ist ein Stammbaum, der die evolutionären Beziehungen zwischen verschiedenen Arten darstellt, von denen man vermutet, dass sie einen gemeinsamen Vorfahren besitzen. Der phylogenetische Baum gleicht somit einem Familienstammbaum, der die verwandtschaftlichen Beziehungen zwischen den einzelnen Familienmitgliedern darstellt.
  • Rezeptor

    Rezeptor

    Ein Rezeptor ist ein Protein oder ein Proteinkomplex, der mit anderen Molekülen oder Proteinen interagiert. Ein Rezeptor ermöglicht unter anderem die Übermittlung von Nachrichten in einer Zelle.
  • Ribosom

    Ribosom

    Ein Ribosom ist eine Proteinfabrik. Es liest die Informationen, die in der Boten-RNA enthalten sind und übersetzt sie mithilfe des genetischen Codes in ein Protein. Jede Zelle besitzt Tausende von Ribosomen.
  • RNA

    RNA

    Eine RNA ist quasi eine Kopie eines DNA-Stückes. Ihre chemische Zusammensetzung ist der von DNA ähnlich, aber sie besteht nur aus einem Strang. RNA dient oft als ‚Bote‘ und ist bei der Proteinproduktion unabdingbar. Es gibt auch andere Arten von RNA, die nicht direkt an der Proteinbiosynthese beteiligt sind.
  • Sequenz

    Sequenz

    Die Reihenfolge der Bausteine eines Makromoleküls (DNA oder Protein). Eine DNA-Sequenz ist eine bestimmte Abfolge der Nukleotide A, T, C, G (z. B.: CAAGGAAGTTTGGCAGAGGA). Eine Proteinsequenz ist die Abfolge von Aminosäuren. Die 20 verschiedenen Aminosäuren werden durch Buchstaben dargestellt: A, C, D, E, F, G, H, I, K, L, M, N, P, Q, R, S, T, V, W, und Y . Beispiel für eine Proteinsequenz: MALWMRLLPLLALLALW.
  • Sequenzieren

    Sequenzieren

    Die Reihenfolge der Nukleotide einer DNA oder die Reihenfolge der Aminosäuren eines Proteins bestimmen.
  • Sequenzierung

    Sequenzierung

    Eine Labortechnik, die die Nukleotidsequenz von Genen oder die Aminosäuresequenz von Proteinen bestimmen kann.
  • Stoffwechsel

    Stoffwechsel

    = Metabolismus. Der Stoffwechsel ist die Gesamtheit aller Synthese- und Abbaureaktionen, die in einer Zelle oder einem Organismus stattfinden.
  • Toxin

    Toxin

    Toxine sind giftige Substanzen, die von Lebewesen wie Bakterien, Schlangen und Insekten gebildet werden.
  • Virus

    Virus

    Ein Virus ist ein parasitischer Mikroorganismus. Es besteht aus einer Proteinhülle, die seine genetische Information (DNA oder RNA) schützt.
  • Zelle

    Zelle

    Eine Zelle ist die kleinste notwendige Einheit zur Bildung eines Lebewesens. Die Anzahl der Zellen pro Art variiert: Bakterien bestehen aus nur einer einzigen Zelle, der Fadenwurm C. elegans aus etwa 1000 Zellen und ein Mensch besitzt mehrere 100 Billionen Zellen.
  • Zucker

    Zucker

    Die Zucker kennt man auch unter den Bezeichnungen „Karbohydrate“ oder „Glykoside“.